ELISA kit for Mouse D-LDH (D-Lactate Dehydrogenase)
E-EL-M0419	Elabscience Biotech	1 plate of 96 wells	EUR 377
Gentaur's D-LDH ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse D-LDH. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse D-LDH (D-Lactate Dehydrogenase) in samples from Serum, Plasma, Cell supernatant

Elabscience Elisa Laboratories manufactures the elabscience elisa vit d kit reagents distributed by Genprice. The Elabscience Elisa Vit D Kit reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact elabscience elisa. Other Elabscience products are available in stock. Specificity: Elabscience Category: Elisa Group: Vit D

ELISA kit for Human PEPD (Peptidase D)
Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PEPD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PEPD. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PEPD (Peptidase D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse CTSD (Cathepsin D)
Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CTSD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CTSD. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse CTSD (Cathepsin D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse CYPD (Cyclophilin D)
Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CYPD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CYPD. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse CYPD (Cyclophilin D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse D2D (D-Dimer)
Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's D2D ELISA kit utilizes the Competitive-ELISA principle. The microtiter plate provided in this kit has been pre-coated with Mouse D2D. During the reaction, Mouse D2D in the sample or standard competes with a fixed amount of Mouse D2D on the Show more
Description: A competitive ELISA kit for quantitative measurement of Mouse D2D (D-Dimer) in samples from Plasma

ELISA kit for Monkey D2D (D-Dimer)
Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's D2D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Monkey D2D. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Monkey D2D (D-Dimer) in samples from Plasma

ELISA kit for Porcine CTSD (Cathepsin D)
Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's CTSD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Porcine CTSD. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Porcine CTSD (Cathepsin D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Porcine D2D (D-Dimer)
Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's D2D ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with Porcine D2D. During the reaction, Porcine D2D in the sample or standard competes with a fixed amount of Porcine D2D Show more
Description: A competitive ELISA kit for quantitative measurement of Porcine D2D (D-Dimer) in samples from Plasma

Vit D information

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

VIT cloning plasmid
CSB-CL025862HU-10ug	Cusabio	10ug	EUR 663
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1974 Sequence: ATGAGGACTGTTGTTCTCACTATGAAGGCATCTGTTATTGAAATGTTCCTTGTTTTGCTGGTGACTGGAGTACATTCAAACAAAGAAACGGCAAAGAAGATTAAAAGGCCCAAGTTCACTGTGCCTCAGATCAACTGCGATGTCAAAGCCGGAAAGATCATCGATCCTGAGTTCA Show more
Description: A cloning plasmid for the VIT gene.

Vitrin (VIT) Antibody
abx037299-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Vitrin (VIT) Antibody
abx025749-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Vitrin (VIT) Antibody
abx025749-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

ELISA kit for VD (Vitamin D)
E-EL-0012	Elabscience Biotech	1 plate of 96 wells	EUR 377
Gentaur's VD ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with VD. During the reaction, VD in the sample or standard competes with a fixed amount of VD on the solid phase supporter Show more
Description: A competitive ELISA kit for quantitative measurement of VD (Vitamin D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human PDGF-D (Platelet Derived Growth Factor D)
E-EL-H2213	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PDGF-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PDGF-D. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PDGF-D (Platelet Derived Growth Factor D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse PDGF-D (Platelet Derived Growth Factor D)
E-EL-M0921	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PDGF-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse PDGF-D. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse PDGF-D (Platelet Derived Growth Factor D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse SP-D (Pulmonary surfactant-associated protein D)
E-EL-M0993	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's SP-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse SP-D. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse SP-D (Pulmonary surfactant-associated protein D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse VEGF-D (Vascular Endothelial Growth Factor D)
E-EL-M1231	Elabscience Biotech	1 plate of 96 wells	EUR 377
Gentaur's VEGF-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse VEGF-D. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse VEGF-D (Vascular Endothelial Growth Factor D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat PDGF-D (Platelet Derived Growth Factor D)
E-EL-R0755	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PDGF-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat PDGF-D. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat PDGF-D (Platelet Derived Growth Factor D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat SP-D (Pulmonary surfactant-associated protein D)
E-EL-R0831	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's SP-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat SP-D. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat SP-D (Pulmonary surfactant-associated protein D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat VEGF-D (Vascular Endothelial Growth Factor D)
E-EL-R1058	Elabscience Biotech	1 plate of 96 wells	EUR 377
Gentaur's VEGF-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat VEGF-D. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat VEGF-D (Vascular Endothelial Growth Factor D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human SP-D (Pulmonary surfactant-associated protein D)
E-EL-H1269	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's SP-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SP-D. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SP-D (Pulmonary surfactant-associated protein D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human VEGF-D (Vascular Endothelial Growth Factor D)
E-EL-H1601	Elabscience Biotech	1 plate of 96 wells	EUR 377
Gentaur's VEGF-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human VEGF-D. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Human VEGF-D (Vascular Endothelial Growth Factor D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human CYPD (Cyclophilin D)
E-EL-H1936	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CYPD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CYPD. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CYPD (Cyclophilin D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human PEPD (Peptidase D)
E-EL-H5575	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PEPD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PEPD. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PEPD (Peptidase D) in samples from Serum, Plasma, Cell supernatant