Elabscience Elisa Vit D Kit

ELISA kit for Mouse D-LDH (D-Lactate Dehydrogenase)

E-EL-M0419 1 plate of 96 wells
EUR 377
  • Gentaur's D-LDH ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse D-LDH. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse D-LDH (D-Lactate Dehydrogenase) in samples from Serum, Plasma, Cell supernatant

Elabscience Elisa Laboratories manufactures the elabscience elisa vit d kit reagents distributed by Genprice. The Elabscience Elisa Vit D Kit reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact elabscience elisa. Other Elabscience products are available in stock. Specificity: Elabscience Category: Elisa Group: Vit D

ELISA kit for Human PEPD (Peptidase D)

1 plate of 96 wells
EUR 534
  • Gentaur's PEPD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PEPD. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PEPD (Peptidase D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse CTSD (Cathepsin D)

1 plate of 96 wells
EUR 534
  • Gentaur's CTSD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CTSD. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse CTSD (Cathepsin D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse CYPD (Cyclophilin D)

1 plate of 96 wells
EUR 534
  • Gentaur's CYPD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CYPD. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse CYPD (Cyclophilin D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse D2D (D-Dimer)

1 plate of 96 wells
EUR 534
  • Gentaur's D2D ELISA kit utilizes the Competitive-ELISA principle. The microtiter plate provided in this kit has been pre-coated with Mouse D2D. During the reaction, Mouse D2D in the sample or standard competes with a fixed amount of Mouse D2D on the
  • Show more
Description: A competitive ELISA kit for quantitative measurement of Mouse D2D (D-Dimer) in samples from Plasma

ELISA kit for Monkey D2D (D-Dimer)

1 plate of 96 wells
EUR 584
  • Gentaur's D2D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Monkey D2D. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Monkey D2D (D-Dimer) in samples from Plasma

ELISA kit for Porcine CTSD (Cathepsin D)

1 plate of 96 wells
EUR 584
  • Gentaur's CTSD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Porcine CTSD. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Porcine CTSD (Cathepsin D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Porcine D2D (D-Dimer)

1 plate of 96 wells
EUR 584
  • Gentaur's D2D ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with Porcine D2D. During the reaction, Porcine D2D in the sample or standard competes with a fixed amount of Porcine D2D
  • Show more
Description: A competitive ELISA kit for quantitative measurement of Porcine D2D (D-Dimer) in samples from Plasma

Vit D information

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

VIT cloning plasmid

CSB-CL025862HU-10ug 10ug
EUR 663
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1974
  • Sequence: ATGAGGACTGTTGTTCTCACTATGAAGGCATCTGTTATTGAAATGTTCCTTGTTTTGCTGGTGACTGGAGTACATTCAAACAAAGAAACGGCAAAGAAGATTAAAAGGCCCAAGTTCACTGTGCCTCAGATCAACTGCGATGTCAAAGCCGGAAAGATCATCGATCCTGAGTTCA
  • Show more
Description: A cloning plasmid for the VIT gene.

Vitrin (VIT) Antibody

abx037299-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Vitrin (VIT) Antibody

abx025749-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Vitrin (VIT) Antibody

abx025749-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ELISA kit for VD (Vitamin D)

E-EL-0012 1 plate of 96 wells
EUR 377
  • Gentaur's VD ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with VD. During the reaction, VD in the sample or standard competes with a fixed amount of VD on the solid phase supporter
  • Show more
Description: A competitive ELISA kit for quantitative measurement of VD (Vitamin D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human PDGF-D (Platelet Derived Growth Factor D)

E-EL-H2213 1 plate of 96 wells
EUR 534
  • Gentaur's PDGF-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PDGF-D. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PDGF-D (Platelet Derived Growth Factor D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse PDGF-D (Platelet Derived Growth Factor D)

E-EL-M0921 1 plate of 96 wells
EUR 534
  • Gentaur's PDGF-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse PDGF-D. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse PDGF-D (Platelet Derived Growth Factor D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse SP-D (Pulmonary surfactant-associated protein D)

E-EL-M0993 1 plate of 96 wells
EUR 534
  • Gentaur's SP-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse SP-D. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse SP-D (Pulmonary surfactant-associated protein D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse VEGF-D (Vascular Endothelial Growth Factor D)

E-EL-M1231 1 plate of 96 wells
EUR 377
  • Gentaur's VEGF-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse VEGF-D. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse VEGF-D (Vascular Endothelial Growth Factor D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat PDGF-D (Platelet Derived Growth Factor D)

E-EL-R0755 1 plate of 96 wells
EUR 534
  • Gentaur's PDGF-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat PDGF-D. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat PDGF-D (Platelet Derived Growth Factor D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat SP-D (Pulmonary surfactant-associated protein D)

E-EL-R0831 1 plate of 96 wells
EUR 534
  • Gentaur's SP-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat SP-D. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat SP-D (Pulmonary surfactant-associated protein D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat VEGF-D (Vascular Endothelial Growth Factor D)

E-EL-R1058 1 plate of 96 wells
EUR 377
  • Gentaur's VEGF-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat VEGF-D. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat VEGF-D (Vascular Endothelial Growth Factor D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human SP-D (Pulmonary surfactant-associated protein D)

E-EL-H1269 1 plate of 96 wells
EUR 534
  • Gentaur's SP-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SP-D. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SP-D (Pulmonary surfactant-associated protein D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human VEGF-D (Vascular Endothelial Growth Factor D)

E-EL-H1601 1 plate of 96 wells
EUR 377
  • Gentaur's VEGF-D ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human VEGF-D. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human VEGF-D (Vascular Endothelial Growth Factor D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human CYPD (Cyclophilin D)

E-EL-H1936 1 plate of 96 wells
EUR 534
  • Gentaur's CYPD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CYPD. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CYPD (Cyclophilin D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human PEPD (Peptidase D)

E-EL-H5575 1 plate of 96 wells
EUR 534
  • Gentaur's PEPD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PEPD. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PEPD (Peptidase D) in samples from Serum, Plasma, Cell supernatant